Forward Primer pCS2+_SlitOR
Version 1

CGGAGCAAGCTTGATTTAGG

SEEK ID: https://research-sharing.cesgo.org/data_files/48?version=1

help Creators and Submitter
Creator
Submitter
Activity

Views: 5292   Downloads: 0

Created: 14th May 2018 at 08:59

Last updated: 14th May 2018 at 09:01

help Attributions

None

Version History

Version 1 (earliest) Created 14th May 2018 at 08:59 by Guillaume Audic

No revision comments

Powered by
(v.1.16.2)
Copyright © 2008 - 2024 The University of Manchester and HITS gGmbH