Forward Primer pCS2+_SlitOR
Version 1

CGGAGCAAGCTTGATTTAGG

Help
help Creators and Submitter
Creator
Submitter
Activity

Views: 2125   Downloads: 0

Created: 14th May 2018 at 08:59

Last updated: 14th May 2018 at 09:01

Last used: 26th May 2022 at 19:37

help Attributions

None

Version History

Version 1 Created 14th May 2018 at 08:59 by Guillaume Audic

No revision comments

Related items

Powered by
(v.1.11.3)
Copyright © 2008 - 2021 The University of Manchester and HITS gGmbH