Forward Primer pCS2+_SlitOR
Version 1

CGGAGCAAGCTTGATTTAGG

Help
help Creators and Submitter
Creator
Submitter
Activity

Views: 1709   Downloads: 0

Created: 14th May 2018 at 08:59

Last updated: 14th May 2018 at 09:01

Last used: 22nd Oct 2021 at 08:54

help Attributions

None

Related items

Powered by
(v.1.10.3)
Copyright © 2008 - 2020 The University of Manchester and HITS gGmbH