Data files

Created At
Go
27 Data files visible to you, out of a total of 52

Résultat séquençage en Forward

Résultat séquençage en Forward

Résultat séquençage en Forward

Résultat de séquençage en Forward

Résultat séquençage en Forward

Résultat séquençage en Forward

Résultat séquençage en Forward

Résultat séquençage en Forward

Résultat séquençage en Forward

Résultat séquençage en Forward

Résultat du séquençage avec le Forward

Résultats du séquençage avec le Forward

Résultats suite à l'amplification avec le primer Forward

CGGAGCAAGCTTGATTTAGG

CTCACTAAAGGGAACAAAAGCTG

Photo du gel d'électrophorèse
Dépôt : 5µl de produit de PCR, 2µl loadding buffer, 5µl H2O
Migration 90V pendant 50 minutes

Creators: Guillaume Audic, Gabriela Caballero Vidal

Submitter: Guillaume Audic

No description specified

Creator: Cyril Monjeaud

Submitter: Cyril Monjeaud

No description specified

Creator: Cyril Monjeaud

Submitter: Cyril Monjeaud

No description specified

Creator: Cyril Monjeaud

Submitter: Cyril Monjeaud

No description specified

Creator: Cyril Monjeaud

Submitter: Cyril Monjeaud

animal phenotype description

Creator: Francois Moreews

Submitter: Francois Moreews

microarray R analysis result

Creator: Francois Moreews

Submitter: Francois Moreews

transcriptomics raw data file

Creator: Francois Moreews

Submitter: Francois Moreews

Image for this workflow

Creator: Cyril Monjeaud

Submitter: Cyril Monjeaud

Powered by
(v.1.10.3)
Copyright © 2008 - 2020 The University of Manchester and HITS gGmbH