Data files

What is a Data file?
3 Data files visible to you, out of a total of 3

CGGAGCAAGCTTGATTTAGG

CTCACTAAAGGGAACAAAAGCTG

Photo du gel d'électrophorèse Dépôt : 5µl de produit de PCR, 2µl loadding buffer, 5µl H2O Migration 90V pendant 50 minutes

Creators: Guillaume Audic, Gabriela Caballero Vidal

Submitter: Guillaume Audic

Powered by
(v.1.16.2)
Copyright © 2008 - 2024 The University of Manchester and HITS gGmbH